Skip to main content

Table 1 Primer sequences

From: Dimethyl fumarate inhibits antibody-induced platelet destruction in immune thrombocytopenia mouse

Gene Primer Sequence (5′-3′)
T-bet F: TCAACCAGCACCAGACAGAG
R: AAACATCCTGTAATGGCTTGTG
Foxp3 F: CACCCAGGAAAGACAGCAACC
R: GCAAGAGCTCTTGTCCATTGA
FcγRI F: CAGCTTCACTTCTCCTTCTACG
R: CTCACACCAGTAGAATCCAGCA
FcγRIIb F: CCAAAAGCCAACCACAGTCA
R: ACTGGTAAAGACCTGCTGGACT
FcγRIV F: CTACTTCTGCAGAGGGCTCAT
R: GAGTCCTATCAGCAGGCAGAATG
β-actin F: ATGTGGATCAGCAAGCAGGA
R: AAGGGTGTAAAACGCAGCTCA