Skip to main content

Table 1 Primers for qRT-PCR

From: A thrombophilia family with protein S deficiency due to protein translation disorders caused by a Leu607Ser heterozygous mutation in PROS1

hPROS1 qRT F CCCGGAAACGGATTATTTTT
hPROS1 qRT R CTCCTTGCCAACCTGGTTTA
hGAPDH F AGAAGGCTGGGGCTCATTTG
hGAPDH R AGGGGCCATCCACAGTCTTC
CopGFP qRT F AGGACAGCGTGATCTTCACC
CopGFP qRT R CTTGAAGTGCATGTGGCTGT